CATGCATGCAAAGACAACGCC

The BioEngineering Theme Song!

Finally bioengineering has what it’s long been missing - a theme song! (scroll down on left side of page). Thanks to NPR and the Mammalian Pituitary Band for producing it, and to my colleague Reshma Shetty for contributing the key lyrics “we’re building stuff!”

Song was part of a larger report on our iGEM project from 2006 - banana & mint smelling E.coli.

Synthetic Biology rant (link)

Sorry for the slow posting, starting a blog while writing up my thesis was not my best idea ever.

While i’m obviously biased on this one, drew just posted a nice rant on The Seven Stones (Nature MSB’s blog) — scroll down to the comments. he tries to maintain a clear definition of synthetic biology, along with notes tossed in about the challenge of convincing editors/scientists that biological engineering should actually contain boring ol’ engineering w/o needing a new scientific discovery tacked on to get published.

If you’d like to get incensed about it you can check out the review on synthetic biology by Luis Serrano published in Nature MSB. My favorite part:

Thus, in my opinion, we should consider a more relaxed use of the term engineering in which the emphasis should be placed on the design and simulation of the new functions and properties, rather than on the standardization of parts.

I’d rather not relax engineering for biology’s sake — fundamental engineering principles have allowed us to tame plenty of other substrates, we’ll get there with biology as well. As a reminder, this was the transistor in 1948 - this stuff isn’t supposed to be pretty at the beginning.

moo… MIT Biological Engineering t-shirts

mootutle.JPG

I have to give credit to the MIT Biological Engineering (Course 20) undergrads, who came up with a classic shirt(s). Seemed like the turtle was the clear favorite at the sale today. This thing is sure to become a permanent MIT feature (rivaling “six hertz six bytes”, no question about it).

mit-other-designs.JPG

Update: The BE Undergraduate Board has posted better pictures of the shirts.

Video Talk: Physical Reference Standards for Bioengineering

I “gave a talk” at the Biobrick foundation technical standards workshop last weekend. Gave a talk is in quotes since I had a previous commitment and couldn’t be there in person. Instead I made a screencast/video presentation that was sent out to the BBF mailing list before the conference and then replayed during the presentations at the conference. The talk was about a simple measurement kit for BioBrick promoters and RBSs and about the need for physical reference standards in biological engineering. The video is below, and probably gets things across more clearly then I could in a post – so take a look if you are interested in the topic.

Wanted to make a quick rant, but before that I should say that the BBF workshop had breakout sessions, lots of pre- and post-conference email discussion, and sounds like it made good use of dragging people to the same locale.

With that out of the way, I personally think the whole get 100 people in a room and have them sit in silence listening to a talk is an enormous waste of time. If you are trying to get people to collaborate by being in physical proximity there are better formats (foo camp / unconferences come to mind). It’s also a bad deal for the busy presenting scientist who has to take a couple days out of her schedule to travel to the talk location.

A better approach might be to mail out a video presentation from a scientist to an email list (say the MIT bioengineering dept list), and then have the presenter on the hook to reply to the first 20 emails received from the talk viewers. The presenter would replace 2 travel days with a 2 hour email session and the talk viewers would get much more detailed Q&A and could watch the talk at their leisure. The Q&A could even be compiled and emailed to the mailing list afterwards, what a helpful resource that would be!

In addition, talks would be higher quality as they could be clipped, edited, and retaken. My talk might not be a great example as I cranked it out the night before heading out on a trip, but I did do a retake of the second half and clipped it in. (try to do that during an in-person talk!)

Overall, I liked the experience of the video talk, and it seems like it wouldn’t be hard to make this standard operating procedure for many talks. Would love to hear your thoughts on this (or on physical ref standards for BE) in the comments.

p.s. I used camtasia studio to make the talk, in case you want to make your own. There are probably free options out there too.

Blue Roses

A new consumer biotech product that has been in the works since the early 90s was announced on Monday - a rose genetically engineered to be blue (looks purple to me).  A Japanese company, Suntory Ltd., is distributing the flowers, however the science was mostly done at Florigene.  Unique house plants seem like an early application area for consumer biotech - genes for new pigments and drought-resistance (my plants could use this!) are obvious alterations.  Anything else on your wishlist?  I’d vote for bonsai trees that didn’t require clipping to stay small.

Consensus Protocols

There is an excellent review just out in Nature Methods describing a ‘consensus protocol’ for protein production and purification. Here it is (fair use, I say!) :

  • Obtain the cDNA by amplifying either genomic DNA (prokaryotic genes, or eukaryotic genes with no introns) or full-length, sequence-verified cDNAs (eukaryotes) or by total gene synthesis.
  • Use ligation-independent cloning (LIC) to clone the full-length cDNA (or the fragment of interest) into an E. coli expression vector.
  • Use T7 RNA polymerase–driven expression and an N-terminal oligohistidine tag (include a cleavage site for a sequence-specific protease to enable removal of the tag).
  • Express the protein in a derivative of the E. coli BL21(DE3) strain, with induction at low temperature (15–25 °C) in rich medium and with good aeration. If expressing proteins from organisms that have codon biases differing from those used by E. coli, use a strain supplemented with the appropriate tRNA genes.
  • Solubilize and purify the protein in a well-buffered solution containing an ionic strength equivalent to 300–500 mM of a monovalent salt, such as NaCl.
  • Use immobilized metal affinity chromatography (IMAC) as the initial purification step.
  • If additional purification is required, use size-exclusion chromatography (gel filtration). If necessary, use ion exchange chromatography as a final ‘polishing’ step.
  • The affinity tag may be removed to minimize non-native sequences in the recombinant protein and to achieve further purification. Use a recombinant, hexahistidine-tagged protease and reapply the sample to IMAC column to remove the protease and any cellular proteins that bound to the metal affinity resin.

The paper is excellent and I recommend giving it a read, but the protocol above is the real take-away. Though it’s offered with the caveat: “although the protocols for the ‘first attempt’ described here have proven to be optimal for the broadest range of proteins, in any individual case, the methods will fail more often than they succeed.” …And that’s why I love biology, fun times.

We’ve also explored consensus protocols on OpenWetWare, the best example being DNA ligation. OpenWetWare protocols does an excellent job accumulating many different variants of protocols as practiced by different labs. However, figuring out the best way to encourage synthesis of those protocols into ‘consensus protocols’ is an important challenge for OWW going forward. Any thoughts are welcome.

Top 10 New Organisms of 2007

Wired lists the Top 10 New Organisms of 2007. These aren’t newly discovered organisms, but rather newly-engineered ones. Much more interesting then discovering some long-eared rodent — though not as cute, I guess. There’s even mention of one of the 2007 iGEM projects, the University of Alberta “butanerds“, who engineered a butanol-producing E.coli. Hopefully this list becomes a yearly Wired feature. Not from this year, but I always thought these were cool and of course MIT’s Eau d’ecoli (though I’m biased on that one). Put your favorite new organisms in the comments.

Video @ the bench

IAmLegendPosterI saw the movie I Am Legend this weekend, and although it wasn’t exactly a ringing endorsement of synthetic biology (re-engineering measles is a bad idea, apparently) Will Smith’s character did have a slick lab in his basement. Good to see a little Garage Biotech in action.

One component of the lab they made heavy use of was a video lab notebook. I assume this was done since Will Smith scribbling in a paper lab notebook wouldn’t have had quite the same cinematic effect. However, getting video into the lab will be important for democratizing biological engineering. A lot of the barriers to would be bio-hackers lay in the difficulty of learning biological protocols from texts. New graduate students benefit enormously from hands-on learning with a mentor in their early days in lab, and without this visual teaching getting booted up in the lab is extremely frustrating.

New science video sites like Jove and Scivee.tv suffer because labs aren’t really equipped to capture video. So at best you’ll be able to disseminate talks, but video protocols are going to be very hard to pull off. I’ve been thinking about video lab notebooks / protocols since Tom Knight brought up some clever ways you might set your bench up to accommodate video capture (cameras in various spots, foot-petal control, and smart ways to handle the data). A more nerdy looking way to do this (no offense to Will Bosworth who used to work around the Endy Lab) is the head-mounted video camera described by Saul Griffith in Make magazine.

will.JPG

There are also some wireless web-cameras that might make your setup cheaper. If anyone is doing a good job of taking video at the bench, please let me know about your setup.

New method for writing genomes

Costs for de novo synthesis of DNA fragments (<10kb) are decreasing rapidly, and challenges now lie in the assembly of these fragments into ever-larger sequences. One of the main challenges is the fragility of long DNA sequences during the in vitro steps associated with traditional methods for assembling DNA. In a recent publication, Itaya et al describe a method for assembling 4-6kb DNA fragments in vivo via incorporation in the B.subtilis genome. They demonstrated this homologous recombination-based method by assembling the 134.5 kb rice chloroplast genome from 31 smaller fragments.The process involves:

1. Cloning alternating, overlapping 4-6kb DNA fragments into one of two custom vectors with different selective markers.

2. Mixing these vectors sequentially with competent B.subtilis and taking advantage of native homologous recombination to add each fragment to a growing chain within the B.subtilis genome.

3. Each new fragment replaces the selective marker added by the previous fragment, allowing the chaining process to continue by switching the antibiotic selection at each step.

4. Removal of the fully assembled DNA construct from the genome and re-circularization via previously described methods.

Due to it’s reliance on homologous recombination, this method faces challenges in assembling sequences with repeated regions. The rice chloroplast genome contains two such repeated regions (21kb each). The authors demonstrate a work-around for this problem by first using their method to assemble three blocks (72.9, 36.7, and 34.4 kb) of the rice chloroplast genome without internal repeating regions, then assembling these blocks as the final construction steps.

This work-around also demonstrates one method for parallelization of their sequential process. Parallelization provides the speedup necessary for construction of larger DNA segments or genomes. Each addition of a 6kb fragment takes a couple days, so building a synthetic E.coli genome (4.6Mb) through purely serial addition of small fragments would take over four years. A parallelized assembly process combined with Itaya’s previous work demonstrating that B.subtilis can handle the incorporation of a 3.5Mb natural genome brings synthetic E.coli-sized genomes closer to reality – will be exciting to watch where this goes.

Note: I wrote this post for The Seven Stones (the Nature Molecular Systems Biology blog), and I’m just co-posting it here and there.

Free Genes

I decided to try out blogging. I find it’s usually a good idea to just jump into things. I’ll try and keep my writing here from meandering too much. I’m hoping to answer a couple questions:

1. What exactly is open source biology and can it be a viable approach for biological engineering?

2. Can we accelerate scientific progress by openly sharing information earlier in the research process?

Also, my day job involves doing wet lab work in the field of synthetic biology (e.g. Biological Engineering), so I’ll talk about that too. Doesn’t work to yell at other scientists about being more open with their work if I’m not practicing what I preach.

Hope you enjoy the blog.