CATGCATGCAAAGACAACGCC

Archive for December, 2007

Top 10 New Organisms of 2007

Wired lists the Top 10 New Organisms of 2007. These aren’t newly discovered organisms, but rather newly-engineered ones. Much more interesting then discovering some long-eared rodent — though not as cute, I guess. There’s even mention of one of the 2007 iGEM projects, the University of Alberta “butanerds“, who engineered a butanol-producing E.coli. Hopefully this list becomes a yearly Wired feature. Not from this year, but I always thought these were cool and of course MIT’s Eau d’ecoli (though I’m biased on that one). Put your favorite new organisms in the comments.

Video @ the bench

IAmLegendPosterI saw the movie I Am Legend this weekend, and although it wasn’t exactly a ringing endorsement of synthetic biology (re-engineering measles is a bad idea, apparently) Will Smith’s character did have a slick lab in his basement. Good to see a little Garage Biotech in action.

One component of the lab they made heavy use of was a video lab notebook. I assume this was done since Will Smith scribbling in a paper lab notebook wouldn’t have had quite the same cinematic effect. However, getting video into the lab will be important for democratizing biological engineering. A lot of the barriers to would be bio-hackers lay in the difficulty of learning biological protocols from texts. New graduate students benefit enormously from hands-on learning with a mentor in their early days in lab, and without this visual teaching getting booted up in the lab is extremely frustrating.

New science video sites like Jove and Scivee.tv suffer because labs aren’t really equipped to capture video. So at best you’ll be able to disseminate talks, but video protocols are going to be very hard to pull off. I’ve been thinking about video lab notebooks / protocols since Tom Knight brought up some clever ways you might set your bench up to accommodate video capture (cameras in various spots, foot-petal control, and smart ways to handle the data). A more nerdy looking way to do this (no offense to Will Bosworth who used to work around the Endy Lab) is the head-mounted video camera described by Saul Griffith in Make magazine.

will.JPG

There are also some wireless web-cameras that might make your setup cheaper. If anyone is doing a good job of taking video at the bench, please let me know about your setup.

New method for writing genomes

Costs for de novo synthesis of DNA fragments (<10kb) are decreasing rapidly, and challenges now lie in the assembly of these fragments into ever-larger sequences. One of the main challenges is the fragility of long DNA sequences during the in vitro steps associated with traditional methods for assembling DNA. In a recent publication, Itaya et al describe a method for assembling 4-6kb DNA fragments in vivo via incorporation in the B.subtilis genome. They demonstrated this homologous recombination-based method by assembling the 134.5 kb rice chloroplast genome from 31 smaller fragments.The process involves:

1. Cloning alternating, overlapping 4-6kb DNA fragments into one of two custom vectors with different selective markers.

2. Mixing these vectors sequentially with competent B.subtilis and taking advantage of native homologous recombination to add each fragment to a growing chain within the B.subtilis genome.

3. Each new fragment replaces the selective marker added by the previous fragment, allowing the chaining process to continue by switching the antibiotic selection at each step.

4. Removal of the fully assembled DNA construct from the genome and re-circularization via previously described methods.

Due to it’s reliance on homologous recombination, this method faces challenges in assembling sequences with repeated regions. The rice chloroplast genome contains two such repeated regions (21kb each). The authors demonstrate a work-around for this problem by first using their method to assemble three blocks (72.9, 36.7, and 34.4 kb) of the rice chloroplast genome without internal repeating regions, then assembling these blocks as the final construction steps.

This work-around also demonstrates one method for parallelization of their sequential process. Parallelization provides the speedup necessary for construction of larger DNA segments or genomes. Each addition of a 6kb fragment takes a couple days, so building a synthetic E.coli genome (4.6Mb) through purely serial addition of small fragments would take over four years. A parallelized assembly process combined with Itaya’s previous work demonstrating that B.subtilis can handle the incorporation of a 3.5Mb natural genome brings synthetic E.coli-sized genomes closer to reality – will be exciting to watch where this goes.

Note: I wrote this post for The Seven Stones (the Nature Molecular Systems Biology blog), and I’m just co-posting it here and there.

Free Genes

I decided to try out blogging. I find it’s usually a good idea to just jump into things. I’ll try and keep my writing here from meandering too much. I’m hoping to answer a couple questions:

1. What exactly is open source biology and can it be a viable approach for biological engineering?

2. Can we accelerate scientific progress by openly sharing information earlier in the research process?

Also, my day job involves doing wet lab work in the field of synthetic biology (e.g. Biological Engineering), so I’ll talk about that too. Doesn’t work to yell at other scientists about being more open with their work if I’m not practicing what I preach.

Hope you enjoy the blog.