CATGCATGCAAAGACAACGCC

Archive for December 14th, 2007

New method for writing genomes

Costs for de novo synthesis of DNA fragments (<10kb) are decreasing rapidly, and challenges now lie in the assembly of these fragments into ever-larger sequences. One of the main challenges is the fragility of long DNA sequences during the in vitro steps associated with traditional methods for assembling DNA. In a recent publication, Itaya et al describe a method for assembling 4-6kb DNA fragments in vivo via incorporation in the B.subtilis genome. They demonstrated this homologous recombination-based method by assembling the 134.5 kb rice chloroplast genome from 31 smaller fragments.The process involves:

1. Cloning alternating, overlapping 4-6kb DNA fragments into one of two custom vectors with different selective markers.

2. Mixing these vectors sequentially with competent B.subtilis and taking advantage of native homologous recombination to add each fragment to a growing chain within the B.subtilis genome.

3. Each new fragment replaces the selective marker added by the previous fragment, allowing the chaining process to continue by switching the antibiotic selection at each step.

4. Removal of the fully assembled DNA construct from the genome and re-circularization via previously described methods.

Due to it’s reliance on homologous recombination, this method faces challenges in assembling sequences with repeated regions. The rice chloroplast genome contains two such repeated regions (21kb each). The authors demonstrate a work-around for this problem by first using their method to assemble three blocks (72.9, 36.7, and 34.4 kb) of the rice chloroplast genome without internal repeating regions, then assembling these blocks as the final construction steps.

This work-around also demonstrates one method for parallelization of their sequential process. Parallelization provides the speedup necessary for construction of larger DNA segments or genomes. Each addition of a 6kb fragment takes a couple days, so building a synthetic E.coli genome (4.6Mb) through purely serial addition of small fragments would take over four years. A parallelized assembly process combined with Itaya’s previous work demonstrating that B.subtilis can handle the incorporation of a 3.5Mb natural genome brings synthetic E.coli-sized genomes closer to reality – will be exciting to watch where this goes.

Note: I wrote this post for The Seven Stones (the Nature Molecular Systems Biology blog), and I’m just co-posting it here and there.

Free Genes

I decided to try out blogging. I find it’s usually a good idea to just jump into things. I’ll try and keep my writing here from meandering too much. I’m hoping to answer a couple questions:

1. What exactly is open source biology and can it be a viable approach for biological engineering?

2. Can we accelerate scientific progress by openly sharing information earlier in the research process?

Also, my day job involves doing wet lab work in the field of synthetic biology (e.g. Biological Engineering), so I’ll talk about that too. Doesn’t work to yell at other scientists about being more open with their work if I’m not practicing what I preach.

Hope you enjoy the blog.