CATGCATGCAAAGACAACGCC

Consensus Protocols

There is an excellent review just out in Nature Methods describing a ‘consensus protocol’ for protein production and purification. Here it is (fair use, I say!) :

  • Obtain the cDNA by amplifying either genomic DNA (prokaryotic genes, or eukaryotic genes with no introns) or full-length, sequence-verified cDNAs (eukaryotes) or by total gene synthesis.
  • Use ligation-independent cloning (LIC) to clone the full-length cDNA (or the fragment of interest) into an E. coli expression vector.
  • Use T7 RNA polymerase–driven expression and an N-terminal oligohistidine tag (include a cleavage site for a sequence-specific protease to enable removal of the tag).
  • Express the protein in a derivative of the E. coli BL21(DE3) strain, with induction at low temperature (15–25 °C) in rich medium and with good aeration. If expressing proteins from organisms that have codon biases differing from those used by E. coli, use a strain supplemented with the appropriate tRNA genes.
  • Solubilize and purify the protein in a well-buffered solution containing an ionic strength equivalent to 300–500 mM of a monovalent salt, such as NaCl.
  • Use immobilized metal affinity chromatography (IMAC) as the initial purification step.
  • If additional purification is required, use size-exclusion chromatography (gel filtration). If necessary, use ion exchange chromatography as a final ‘polishing’ step.
  • The affinity tag may be removed to minimize non-native sequences in the recombinant protein and to achieve further purification. Use a recombinant, hexahistidine-tagged protease and reapply the sample to IMAC column to remove the protease and any cellular proteins that bound to the metal affinity resin.

The paper is excellent and I recommend giving it a read, but the protocol above is the real take-away. Though it’s offered with the caveat: “although the protocols for the ‘first attempt’ described here have proven to be optimal for the broadest range of proteins, in any individual case, the methods will fail more often than they succeed.” …And that’s why I love biology, fun times.

We’ve also explored consensus protocols on OpenWetWare, the best example being DNA ligation. OpenWetWare protocols does an excellent job accumulating many different variants of protocols as practiced by different labs. However, figuring out the best way to encourage synthesis of those protocols into ‘consensus protocols’ is an important challenge for OWW going forward. Any thoughts are welcome.

Write a comment