CATGCATGCAAAGACAACGCC

Synthetic Biology

Build a Lifeform Contest

spore editorSci-fi blog io9 is running a contest to design cool new “lifeforms”, from the site:

The important thing to remember is that this contest is about creating cool new lifeforms that are also, in some way, entertaining. So each entry will be judged for plausibility (i.e. whether it is scientifically justifiable), creativity, usefulness, and entertainment value.

There are two categories and you either win a trip to the Synthetic Biology 4.0 conference in Hong Kong (where you can hear me ranting about reference standards or see lots of other cool stuff) or 1,000 bucks and a comic rendering of your creature.

I already listed some of my favorite synthetic “lifeforms” maybe one of those will be submitted - apparently you get bonus points if you’ve actually implemented your lifeform.

The judges include Drew Endy, Michael Eisen, Spore game developer Jason Shankel, and biology researcher/io9 “ask a biogeek” columnist Terry Johnson. So get designing!

Synthetic Biology rant (link)

Sorry for the slow posting, starting a blog while writing up my thesis was not my best idea ever.

While i’m obviously biased on this one, drew just posted a nice rant on The Seven Stones (Nature MSB’s blog) — scroll down to the comments. he tries to maintain a clear definition of synthetic biology, along with notes tossed in about the challenge of convincing editors/scientists that biological engineering should actually contain boring ol’ engineering w/o needing a new scientific discovery tacked on to get published.

If you’d like to get incensed about it you can check out the review on synthetic biology by Luis Serrano published in Nature MSB. My favorite part:

Thus, in my opinion, we should consider a more relaxed use of the term engineering in which the emphasis should be placed on the design and simulation of the new functions and properties, rather than on the standardization of parts.

I’d rather not relax engineering for biology’s sake — fundamental engineering principles have allowed us to tame plenty of other substrates, we’ll get there with biology as well. As a reminder, this was the transistor in 1948 - this stuff isn’t supposed to be pretty at the beginning.

moo… MIT Biological Engineering t-shirts

mootutle.JPG

I have to give credit to the MIT Biological Engineering (Course 20) undergrads, who came up with a classic shirt(s). Seemed like the turtle was the clear favorite at the sale today. This thing is sure to become a permanent MIT feature (rivaling “six hertz six bytes”, no question about it).

mit-other-designs.JPG

Update: The BE Undergraduate Board has posted better pictures of the shirts.

Video Talk: Physical Reference Standards for Bioengineering

I “gave a talk” at the Biobrick foundation technical standards workshop last weekend. Gave a talk is in quotes since I had a previous commitment and couldn’t be there in person. Instead I made a screencast/video presentation that was sent out to the BBF mailing list before the conference and then replayed during the presentations at the conference. The talk was about a simple measurement kit for BioBrick promoters and RBSs and about the need for physical reference standards in biological engineering. The video is below, and probably gets things across more clearly then I could in a post – so take a look if you are interested in the topic.

Wanted to make a quick rant, but before that I should say that the BBF workshop had breakout sessions, lots of pre- and post-conference email discussion, and sounds like it made good use of dragging people to the same locale.

With that out of the way, I personally think the whole get 100 people in a room and have them sit in silence listening to a talk is an enormous waste of time. If you are trying to get people to collaborate by being in physical proximity there are better formats (foo camp / unconferences come to mind). It’s also a bad deal for the busy presenting scientist who has to take a couple days out of her schedule to travel to the talk location.

A better approach might be to mail out a video presentation from a scientist to an email list (say the MIT bioengineering dept list), and then have the presenter on the hook to reply to the first 20 emails received from the talk viewers. The presenter would replace 2 travel days with a 2 hour email session and the talk viewers would get much more detailed Q&A and could watch the talk at their leisure. The Q&A could even be compiled and emailed to the mailing list afterwards, what a helpful resource that would be!

In addition, talks would be higher quality as they could be clipped, edited, and retaken. My talk might not be a great example as I cranked it out the night before heading out on a trip, but I did do a retake of the second half and clipped it in. (try to do that during an in-person talk!)

Overall, I liked the experience of the video talk, and it seems like it wouldn’t be hard to make this standard operating procedure for many talks. Would love to hear your thoughts on this (or on physical ref standards for BE) in the comments.

p.s. I used camtasia studio to make the talk, in case you want to make your own. There are probably free options out there too.

Video @ the bench

IAmLegendPosterI saw the movie I Am Legend this weekend, and although it wasn’t exactly a ringing endorsement of synthetic biology (re-engineering measles is a bad idea, apparently) Will Smith’s character did have a slick lab in his basement. Good to see a little Garage Biotech in action.

One component of the lab they made heavy use of was a video lab notebook. I assume this was done since Will Smith scribbling in a paper lab notebook wouldn’t have had quite the same cinematic effect. However, getting video into the lab will be important for democratizing biological engineering. A lot of the barriers to would be bio-hackers lay in the difficulty of learning biological protocols from texts. New graduate students benefit enormously from hands-on learning with a mentor in their early days in lab, and without this visual teaching getting booted up in the lab is extremely frustrating.

New science video sites like Jove and Scivee.tv suffer because labs aren’t really equipped to capture video. So at best you’ll be able to disseminate talks, but video protocols are going to be very hard to pull off. I’ve been thinking about video lab notebooks / protocols since Tom Knight brought up some clever ways you might set your bench up to accommodate video capture (cameras in various spots, foot-petal control, and smart ways to handle the data). A more nerdy looking way to do this (no offense to Will Bosworth who used to work around the Endy Lab) is the head-mounted video camera described by Saul Griffith in Make magazine.

will.JPG

There are also some wireless web-cameras that might make your setup cheaper. If anyone is doing a good job of taking video at the bench, please let me know about your setup.

New method for writing genomes

Costs for de novo synthesis of DNA fragments (<10kb) are decreasing rapidly, and challenges now lie in the assembly of these fragments into ever-larger sequences. One of the main challenges is the fragility of long DNA sequences during the in vitro steps associated with traditional methods for assembling DNA. In a recent publication, Itaya et al describe a method for assembling 4-6kb DNA fragments in vivo via incorporation in the B.subtilis genome. They demonstrated this homologous recombination-based method by assembling the 134.5 kb rice chloroplast genome from 31 smaller fragments.The process involves:

1. Cloning alternating, overlapping 4-6kb DNA fragments into one of two custom vectors with different selective markers.

2. Mixing these vectors sequentially with competent B.subtilis and taking advantage of native homologous recombination to add each fragment to a growing chain within the B.subtilis genome.

3. Each new fragment replaces the selective marker added by the previous fragment, allowing the chaining process to continue by switching the antibiotic selection at each step.

4. Removal of the fully assembled DNA construct from the genome and re-circularization via previously described methods.

Due to it’s reliance on homologous recombination, this method faces challenges in assembling sequences with repeated regions. The rice chloroplast genome contains two such repeated regions (21kb each). The authors demonstrate a work-around for this problem by first using their method to assemble three blocks (72.9, 36.7, and 34.4 kb) of the rice chloroplast genome without internal repeating regions, then assembling these blocks as the final construction steps.

This work-around also demonstrates one method for parallelization of their sequential process. Parallelization provides the speedup necessary for construction of larger DNA segments or genomes. Each addition of a 6kb fragment takes a couple days, so building a synthetic E.coli genome (4.6Mb) through purely serial addition of small fragments would take over four years. A parallelized assembly process combined with Itaya’s previous work demonstrating that B.subtilis can handle the incorporation of a 3.5Mb natural genome brings synthetic E.coli-sized genomes closer to reality – will be exciting to watch where this goes.

Note: I wrote this post for The Seven Stones (the Nature Molecular Systems Biology blog), and I’m just co-posting it here and there.