CATGCATGCAAAGACAACGCC

Uncategorized

OWW Community Blog Launched

I got my PhD, which means I should have a little more time to blog now. Wanted to give a quick pointer to the OpenWetWare community blog that has recently been revamped by Ricard Vidal. The blog will cover Open Science (both on OpenWetWare and elsewhere) so keep an eye on it if you’re into that sort of thing. If you’d like to do a guest post or have written a post on your own blog that you’d like to have highlighted (the community blog shows up on the OWW homepage), please email Ricardo.

The BioEngineering Theme Song!

Finally bioengineering has what it’s long been missing - a theme song! (scroll down on left side of page). Thanks to NPR and the Mammalian Pituitary Band for producing it, and to my colleague Reshma Shetty for contributing the key lyrics “we’re building stuff!”

Song was part of a larger report on our iGEM project from 2006 - banana & mint smelling E.coli.

Consensus Protocols

There is an excellent review just out in Nature Methods describing a ‘consensus protocol’ for protein production and purification. Here it is (fair use, I say!) :

  • Obtain the cDNA by amplifying either genomic DNA (prokaryotic genes, or eukaryotic genes with no introns) or full-length, sequence-verified cDNAs (eukaryotes) or by total gene synthesis.
  • Use ligation-independent cloning (LIC) to clone the full-length cDNA (or the fragment of interest) into an E. coli expression vector.
  • Use T7 RNA polymerase–driven expression and an N-terminal oligohistidine tag (include a cleavage site for a sequence-specific protease to enable removal of the tag).
  • Express the protein in a derivative of the E. coli BL21(DE3) strain, with induction at low temperature (15–25 °C) in rich medium and with good aeration. If expressing proteins from organisms that have codon biases differing from those used by E. coli, use a strain supplemented with the appropriate tRNA genes.
  • Solubilize and purify the protein in a well-buffered solution containing an ionic strength equivalent to 300–500 mM of a monovalent salt, such as NaCl.
  • Use immobilized metal affinity chromatography (IMAC) as the initial purification step.
  • If additional purification is required, use size-exclusion chromatography (gel filtration). If necessary, use ion exchange chromatography as a final ‘polishing’ step.
  • The affinity tag may be removed to minimize non-native sequences in the recombinant protein and to achieve further purification. Use a recombinant, hexahistidine-tagged protease and reapply the sample to IMAC column to remove the protease and any cellular proteins that bound to the metal affinity resin.

The paper is excellent and I recommend giving it a read, but the protocol above is the real take-away. Though it’s offered with the caveat: “although the protocols for the ‘first attempt’ described here have proven to be optimal for the broadest range of proteins, in any individual case, the methods will fail more often than they succeed.” …And that’s why I love biology, fun times.

We’ve also explored consensus protocols on OpenWetWare, the best example being DNA ligation. OpenWetWare protocols does an excellent job accumulating many different variants of protocols as practiced by different labs. However, figuring out the best way to encourage synthesis of those protocols into ‘consensus protocols’ is an important challenge for OWW going forward. Any thoughts are welcome.

Top 10 New Organisms of 2007

Wired lists the Top 10 New Organisms of 2007. These aren’t newly discovered organisms, but rather newly-engineered ones. Much more interesting then discovering some long-eared rodent — though not as cute, I guess. There’s even mention of one of the 2007 iGEM projects, the University of Alberta “butanerds“, who engineered a butanol-producing E.coli. Hopefully this list becomes a yearly Wired feature. Not from this year, but I always thought these were cool and of course MIT’s Eau d’ecoli (though I’m biased on that one). Put your favorite new organisms in the comments.